Cannabidiol as a novel inhibitor of Id-1 gene expression in aggressive breast cancer cells

Cannabidiol as a novel inhibitor of Id-1 gene expressionin aggressive breast cancer cells

Sean D. McAllister, Rigel T. Christian,
Maxx P. Horowitz, Amaia Garcia,
and Pierre-Yves Desprez
California Pacific Medical Center, Research Institute,
San Francisco, California
Abstract
Invasion and metastasis of aggressive breast cancer cells
is the final and fatal step during cancer progression, and
is the least understood genetically. Clinically, there are still
limited therapeutic interventions for aggressive and metastatic breast cancers available. Clearly, effective and nontoxic therapies are urgently required. Id-1, an inhibitor of
basic helix-loop-helix transcription factors, has recently
been shown to be a key regulator of the metastatic
potential of breast and additional cancers. Using a mouse
model, we previously determined that metastatic breast
cancer cells became significantly less invasive in vitro and
less metastatic in vivo when Id-1 was down-regulated by
stable transduction with antisense Id-1. It is not possible
at this point, however, to use antisense technology to
reduce Id-1 expression in patients with metastatic breast
cancer. Here, we report that cannabidiol (CBD), a cannabinoid with a low-toxicity profile, could down-regulate
Id-1 expression in aggressive human breast cancer cells.
The CBD concentrations effective at inhibiting Id-1 expression correlated with those used to inhibit the proliferative
and invasive phenotype of breast cancer cells. CBD was
able to inhibit Id-1 expression at the mRNA and protein
level in a concentration-dependent fashion. These effects
seemed to occur as the result of an inhibition of the
Id-1 gene at the promoter level. Importantly, CBD did
not inhibit invasiveness in cells that ectopically expressed
Id-1. In conclusion, CBD represents the first nontoxic
exogenous agent that can significantly decrease Id-1
expression in metastatic breast cancer cells leading to the
down-regulation of tumor aggressiveness. [Mol Cancer
Ther 2007;6(11):2921–7]
Introduction
The development of breast cancer and its spread to other
parts of the body requires several genotypic and phenotypic changes in the cells leading to de-differentiation,
uncontrolled proliferation, and invasion. Invasion and
metastasis to the other tissues of the body is the final and
fatal step during cancer progression and is the least
understood genetically (1). Despite all currently available
treatments, breast cancer is most often incurable once
clinically apparent metastases develops.
Id helix-loop-helix proteins are negative regulators of
basic helix-loop-helix transcription factors (2). Strong evidence now suggests that the Id family of helix-loop-helix
proteins control cellular processes related to tumor progression (3). We found that reducing Id-1 using antisense
technology led to significant reductions in breast cancer
cell proliferation and invasiveness in vitro and metastasis
in vivo in mice (4). Furthermore, Id-1 overexpression in
breast cancer cells was also found to be one of the most
significant genes within a gene signature set that is correlated with the propensity of primary human breast cancer cells to metastasize to the lung (5).
Reducing Id-1 expression could provide a rational
therapeutic strategy for the treatment of aggressive human
breast cancers. It is not possible at this point, however,
to use antisense technology to reduce Id-1 expression in
humans with metastatic breast cancer. In our search for a
nontoxic exogenous compound that could inhibit Id-1 expression, a potential candidate agent, cannabidiol (CBD),
was discovered.
The endocannabinoid system was discovered through
research focusing on the primary psychoactive component
of Cannabis sativa, D
9
-tetrahydrocannabinol (D
9
-THC), and
other synthetic cannabinoids (6). D
9
-THC and additional
cannabinoid agonists have been shown to interact with two
G protein – coupled receptors named CB1 and CB2 (6). More
recent studies have shown that CB1 and CB2 receptor
agonists show promise as tumor inhibitors (7, 8). The
psychotropic effects of D
9
-THC and additional cannabinoid
agonists, mediated through the CB1
receptor, limit their
clinical utility. In addition to D
9
-THC, CBD is also present
in significant quantities in C. sativa (9). CBD does not have
appreciable affinity for CB1 or CB2 receptors and does not
have psychotropic activities (10). CBD has been shown to
inhibit breast cancer metastasis in vivo in mice (11).
However, modulation of a distinct signaling pathway that
would explain the inhibitory action of CBD on breast
cancer metastasis has not been elucidated.
Received 6/4/07; revised 9/5/07; accepted 9/20/07.
Grant support: NIH (CA102412, CA111723, DA09978, and CA82548),
the Department of Defense (PC041013), the California Breast Cancer
Research Program (12IB-0116), and the Research Institute at California
Pacific Medical Center.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
advertisement in accordance with 18U.S.C. Section 1734 solely to
indicate this fact.
Requests for reprints: Sean D. McAllister, California Pacific Medical
Center, Research Institute, 475 Brannan Street, San Francisco, CA
94107. Phone: 415-600-5926; Fax: 415-600-1725.
E-mail: mcallis@cpmcri.org
Copyright C 2007 American Association for Cancer Research.
doi:10.1158/1535-7163.MCT-07-0371
2921
Mol Cancer Ther 2007;6(11). November 2007Our data presented here show that CBD represents the
first exogenous agent that can down-regulate Id-1 expression in aggressive hormone-independent breast cancer
cells. We suggest that CBD down-regulation of Id-1 and
corresponding inhibition of human breast cancer cell
proliferation and invasiveness provides a potential mechanism for the antimetastatic activity of the compound.
Materials and Methods
Cell Culture and Treatments
We used the human breast cancer cells lines MDA-MB231
and MDA-MB436 obtained from American Type Culture
Collection. To prepare the MDA-MB231-Id-1 cells, cells
were infected with a pLXSN-Id-1 sense expression vector.
In all experiments, the different cell populations were first
cultured in RPMI medium containing 10% fetal bovine
serum. On the first day of treatment, the medium was
replaced with vehicle control or drug in RPMI and 0.1%
fetal bovine serum as previously reported (12). The media
with the appropriate compounds were replaced every 24 h.
D
9
-THC, CBN, CBD, CBG, and CP55,940 were obtained
from the NIH through the National Institute of Drug
Abuse. WIN55,212-2 was purchased from Sigma-RBI.
MTT Assay
To quantify cell proliferation, the MTT assay was used
(Chemicon). Cells were seeded in 96-well plates. Upon
completion of the drug treatments, cells were incubated at
37jC with MTT for 4 h, and then isopropanol with 0.04 N
HCl was added and the absorbance was read after 1 h in
a plate reader with a test wavelength of 570 nm. The
absorbance of the medium alone at 570 nm was subtracted,
and percentage control was calculated as the absorbance
of the treated cells/control cells 100.
Boyden Chamber Invasion Assay
Assays were done in modified Boyden chambers (BD
Biosciences) as previously described (4). Cells at 1.5 10
4
per well were added to the upper chamber in 500 AL of
serum-free medium supplemented with insulin (5 Ag/mL).
The lower chamber was filled with 500 AL of conditioned
medium from fibroblasts. After a 20-h incubation, cells
were fixed and stained as previously described (4). Cells
that remained in the Matrigel or attached to the upper side
of the filter were removed with cotton tips. Invasive breast
cancer cells on the lower side of the filter were counted
using a light microscope.
QuantitativeWestern Analysis
Proteins were separated by SDS-PAGE, blotted on Immobilon membrane, and probed with anti – Id-1 and the
appropriate secondary antibody as previously described
(4, 13). Band intensity values were obtained directly from the
blot using AlphaeaseFC software or from film using Image-J
(NIH). As a normalization control for loading, blots were
stripped and reprobed with mouse alpha-tubulin (Abcam).
PCR
Total cellular RNA was isolated from breast cancer
cells treated with vehicle control or with CBD. Transcripts
for Id-1 and for h-actin were reverse-transcribed using
Superscript II Reverse Transcriptase II (Life Technologies),
and PCR was done. The 5¶ and 3¶ PCR primers were
AGGTGGTGCGCTGTCTGTCT and TAATTCCTCTTGCCCCCTGG for Id-1; and GCGGGAAATCGTGCGTGACATT
and GATGGAGTTGAAGGTAGTTTCGTG for h-actin.
PCR was done in buffer containing 1 Amol/L of each of
the 5¶ and 3¶ PCR primers and 0.5 units of Taq polymerase
using 25 cycles for amplification of Id-1 and h-actin cDNAs.
The cycle conditions were 45 s denaturation at 94jC, 45 s
annealing at 55jC, and 1 min extension at 72jC.
Id-1Promoter Reporter Assays
A SacI-BspHI fragment of 2.2 kb corresponding to the
5¶ upstream region of human Id-1 gene and driving a
luciferase gene in a PGL-3 vector (Promega) has already
been described (Id-1-sbsluc; ref. 13). Cells were plated in
six-well dishes in medium supplemented with 10% fetal
bovine serum and 5 Ag/mL insulin. After 24 h, cells were
cotransfected with 6 Ag of luciferase reporter plasmids and
2 Ag of pCMVh (Clontech) using Superfect reagent
(Qiagen). pCMVh contained bacterial h-galactosidase and
served to control for variation in transfection efficiency.
Three hours after transfection, the cells were rinsed twice
with PBS and were cultured in the absence or presence
of CBD for 48 to 72h. Cell pellets were lysed in 80 AL of
reporter lysis buffer (Promega) for 10 min at room temperature. Lysed cells were centrifuged and supernatants
harvested. Luciferase and h-gal assays were done using
Luciferase assay system (Promega), h-Gal assay kit (Clontech), and a 2010 luminometer (PharMingen).
Statistical Analysis
The IC50 values with corresponding 95% confidence
limits were compared by analysis of logged data (GraphPad Prism). When only the confidence limits of the IC50
Table 1. Antiproliferative potencies of cannabinoids during a
3-d treatment of MDA-MB231 and MDA-MB436 breast cancer
cells
Compound MDA-MB231 MDA-MB436
O
H3
C
H3
C
OH
CH3
CH3
D9
-THC 1.2(1.0 – 1.4) 2.5 (1.8 – 3.4)
H3
C
H3
C
OH
CH3
O CH3
CBN 1.2(0.9 – 1.5) 2.6 (1.8 – 3.7)
N CH3
O
O
N(CH2
CH2
)
2
0
WIN55,212-2 1.7 (1.5 – 2.2) 2.4 (1.6 – 3.4)
H3
C
OH
OH
OH
CH3
CH3
CP55,940 2.5 (1.5 – 4.1) 1.3 (0.7 – 1.6)
H3
C
H2
C
OH
HO CH3
CH3
CBD 1.3 (1.0 – 1.9) 1.6 (1.1 – 2.2)
H3C
CH3
CH3
HO
OH
CH3
CBG 2.3 (2.1 – 2.5) 2.1 (1.5 – 3.0)
NOTE: Cells were treated with cannabinoid compounds for 3 d and the
IC50 values for the antiproliferative effects of the compounds were
calculated. Data are the means and corresponding 95% confidence limits
of at least three experiments. IC50 values are reported in Amol/L.
2922 Cannabidiol and Id-1 in Breast Cancer
Mol Cancer Ther 2007;6(11). November 2007values overlapped, significant differences were determined
using unpaired Student’s t test. Significant differences were
also determined (Prism) using ANOVA or the unpaired
Student’s t test, where suitable. Bonferroni-Dunn post
hoc analyses were conducted when appropriate. P < 0.05
values defined statistical significance.
Results
Cannabinoids Reduce the Growth of Aggressive Human Breast Cancer Cells
In order to test their antiproliferative activities, three
groups of cannabinoid compounds were chosen: (a)
natural cannabis constituents that have affinity for CB1
and CB2
receptors, D
9
-THC and CBN; (b) synthetic
cannabinoid analogues that have high affinity for CB1
and CB2 receptors, WIN55,212-2 and CP55,940; and (c)
natural cannabis constituents that do not have appreciable affinity for CB1 and CB2 receptors, CBD and CBG.
Breast cancer cells were treated for 3 days and IC50
values were calculated (Table 1). The rank order of
potencies for the antiproliferative effects of the cannabinoids in MDA-MB231 cells was: CBD = D
9
-THC = CBN >
WIN55,212-2 > CBG = CP55,940. The rank order of
potencies for the antiproliferative effects of the cannabinoids in MDA-MB436 cells was: CBD = CP55,940 > CBG =
WIN55,212-2 = D
9
-THC = CBN. Overall, the data showed
that CBD was the most effective inhibitor of human breast
cancer cell proliferation.
Cannabinoids Reduce Breast Cancer Cell Invasiveness
Invasion is an important step towards breast cancer
cell metastasis. Therefore, we next determined the effects of
several cannabinoids on the ability of the most aggressive
human breast cancer cell line, MDA-MB231, to migrate and
invade a reconstituted basement membrane in a Boyden
chamber. All three compounds tested, i.e., CBD, D
9
-THC,
and WIN55,212-2, significantly reduced the invasion of
MDA-MB231 cells (Fig. 1A). Again, as was observed with
the cell proliferation experiments, the most potent inhibitor
of invasion was CBD.
Figure 1. CBD is the most effective inhibitor of invasiveness and Id-1 expression in MDA-MD231 cells. A, the Boyden chamber invasion assay was used
to determine the effects of cannabinoids on the invasiveness of aggressive human breast cancer MDA-MB231 cells. Compounds were added at
concentrations of 0.1, 1.0, or 1.5 Amol/L. Data are presented as relative invasiveness of the cells through the Matrigel, where the respective controls are
set as 100%. B, proteins from MDA-MB231 cells treated with vehicle (control), 0.1, 1.0, or 1.5 Amol/L of CBD for 3 d were extracted and analyzed for
Id-1 by Western blot analysis as described in Materials and Methods. C, proteins from MDA-MB231 cells treated with additional cannabinoids for 3 d
were extracted and analyzed for Id-1 by Western blot analysis. Normalization was carried out by stripping the blots and reprobing with a monoclonal
antitubulin antibody. Densitometry readings of the blots were taken and the percentage of relative expression was calculated as the expression of Id-1 in
the treated cells / vehicle cells 100. D, the inhibitory effect of 1.5 Amol/L of CBD on Id-1 expression was compared over a time course of 1, 2, and 3 d.
Columns, mean of at least three replicates; bars, SE. Data were compared using a one-way ANOVA with a corresponding Dunnett’s post hoc test.
*, P < 0.05, statistically significant differences from control.
Molecular Cancer Therapeutics 2923
Mol Cancer Ther 2007;6(11). November 2007CBD Down-regulates Id-1Expression
We predicted that CBD, the most potent inhibitor of
breast cancer cell proliferation and invasion tested, would
regulate the expression of key genes that control breast
cancer cell proliferation and invasiveness. A potential
candidate protein that could mediate the effects of CBD
on both phenotypes was the helix-loop-helix protein Id-1.
We determined that treatment of MDA-MB231 cells with
CBD led to a concentration-dependent inhibition of Id-1
protein expression (Fig. 1B and C). The inhibitory effect of
CBD on Id-1 expression occurred at concentrations as low
as 100 nmol/L. CBD was significantly more effective at
reducing Id-1 protein expression compared with other cannabinoid compounds (Fig. 1C). The CBD concentrations
effective at inhibiting Id-1 expression correlated with those
used to inhibit the proliferative and invasive phenotype of
MDA-MB231 cells. Furthermore, the down-regulation of
Id-1 protein in the presence of CBD seemed to precede,
and not follow, the inhibitory effects of CBD on the
proliferation and invasiveness of MDA-MB231 cells
(Fig. 1D), suggesting that Id-1 down-regulation represents
a cause rather than a consequence of a decrease in breast
cancer cell aggressiveness.
The Effects of CBD on Invasion and Id-1 Protein Expression Can Be Reproduced in an Additional Breast
Cancer Cell Line
Based on the data presented in Table 1, CBD could also
decrease cell proliferation in another breast cancer cell
line other than MDA-MB231, the MDA-MB436 cells. The
metastatic cell line MDA-MB436 is able to invade
through the peritoneum and colonize visceral organs
when injected in athymic nude mice (14). However, these
cells are less metastatic than the MDA-MB231 cell line.
Using the MDA-MB436 cells, we confirmed the effects of
CBD on a decrease of cell invasion (Fig. 2A) associated
with a down-regulation of Id-1 protein expression
(Fig. 2B and C). These data suggest that the effects of
CBD on breast cancer cell phenotypes, potentially
through a decrease in Id-1 expression, are not restricted
to one particular cell line but could represent a more
general phenomenon.
CBD Inhibits theTranscription of the Id-1Gene
In order to determine if CBD modulated Id-1 at the
gene expression level, we investigated if Id-1 mRNA
was down-regulated by CBD. As shown in Fig. 3A using
reverse transcription-PCR, Id-1 mRNA expression was
significantly reduced upon treatment with CBD in MDAMB231 cells. To determine if this effect was due to the
inhibition of transcription, a construct was used that
contained the Id-1 promoter fused to a luciferase reporter
in a PGL-3 basic vector. This construct was transiently
transfected, and 24 h after transfection, MDA-MB231-Id-
1-luc cells were treated with CBD for 2or 3 days and
luciferase activity was measured. Transfection efficiency
and analysis of equal amounts of total protein were
controlled by cotransfection of the cells with pCMVB
containing h-galactosidase. Treatment with CBD resulted
in a significant inhibition of luciferase activity, with the
greatest inhibition occurring on day 3 (Fig. 3B and C).
The effect on the down-regulation of Id-1 mRNA and
promoter expression could also be reproduced in the
MDA-MB436 cell line (Fig. 3D and E). Overall, all these
findings correlated with the inhibition of Id-1 expression
as assessed by Western analysis.
CBD Does Not Inhibit Cell Invasiveness in Cells that
Ectopically Express Id-1
To determine if Id-1 represented a key mediator of
CBD effects in highly aggressive breast cancer cells, Id-1
was constitutively expressed into MDA-MB231 cells (+Id-
1 as described in Fig. 4). The ectopic Id-1 gene, which is
not under the control of the endogenous promoter, was
introduced in the cells using the pLXSN retroviral vector.
Figure 2. CBD reduces invasion as well as Id-1 expression in MDA-MD436 cells. A, the Boyden chamber invasion assay was used to determine the
effects of CBD on the invasiveness of human breast cancer MDA-MB436 cells. Data are presented as relative invasiveness of the cells through the Matrigel,
where the respective controls are set as 100%. B, proteins from MDA-MB436 cells treated with vehicle (control) or 2.0 Amol/L of CBD for 3 d were
extracted and analyzed for Id-1 by Western blot analysis. Normalization was carried out by stripping the blots and reprobing with a monoclonal antitubulin
antibody. C, densitometry readings of the blots were taken from three independent experiments and the percentage of relative expression was calculated
as the expression of Id-1 in the treated cells / vehicle cells 100. *, P < 0.05, statistically significant differences from control.
2924 Cannabidiol and Id-1 in Breast Cancer
Mol Cancer Ther 2007;6(11). November 2007As a control, cells were infected with an empty pLXSN
vector ( Id-1). Ectopic Id-1 expression increased invasion
in MDA-MB231 cells in agreement with our previous
studies (13, 15). However, the difference in invasion
between cells that ectopically expressed Id-1, or the
control vector lacking Id-1, was not reflected in Fig. 3A
because the data was represented as relative invasiveness
(with all the control cells set at 100%). In cells expressing
the control vector, treatment with CBD led to a significant reduction in cell invasiveness (Fig. 4A). Western
blotting confirmed the down-regulation of Id-1 expression in this cell population (Fig. 4B). Importantly, and in
contrast with the results in control cells, CBD did not
inhibit cell invasiveness (Fig. 4A) or Id-1 expression
(Fig. 4B) in MDA-MB231+Id-1 cells that ectopically
expressed Id-1.
Discussion
Metastasis is the final and fatal step in the progression of
breast cancer. Currently available therapeutic strategies at
this stage of cancer progression are often nonspecific, have
only marginal efficacy, and are highly toxic. This is in part
due to the lack of knowledge about the molecular mechanisms regulating the development of aggressive cancers.
Therapeutic approaches targeting only specific mechanisms involved in the development of aggressive breast
cancers are urgently need. The expectation would be that
this strategy would reduce unwanted toxicities associated
with the therapy itself.
We previously showed that the helix-loop-helix protein
Id-1, an inhibitor of basic helix-loop-helix transcription factors, plays a crucial role during breast cancer progression
(4). Id-1 stimulated proliferation, migration, and invasion
in breast cancer cells (13, 16). Moreover, targeting Id-1
expression partially in breast cancer cells reduced invasion
in vitro and breast cancer metastasis in preclinical animal
models (4, 5). Based on these data, we hypothesized that
Id-1 could be a promising candidate for future therapy
approaches, and that inhibiting Id-1 expression and/or
activity might be of benefit for patients with breast cancer. This approach may be highly effective and safe in
advanced breast cancer patients, given (a) the relationship
between high Id-1 expression levels and aggressive breast
Figure 3. CBD inhibits the expression of Id-1 gene at the mRNA and promoter levels in MDA-MB231 and MDA-MB436 cells. A, the inhibition of the Id-1
gene product (434 bp) by CBD was investigated in MDA-MB231 cells using reverse transcription-PCR. Expression of the h-actin gene product (232 bp) was
used as a control. B, luciferase activity in MDA-MB231 cells transiently transfected with Id-1-sbsluc was determined in the presence of vehicle (control) or
1.5 Amol/L of CBD. Cells were treated for 2 d and luciferase activity was measured. C, cells were treated for 3 d. For both B and C, all values were
normalized for the amount of h-gal activity present in the cell extracts. Columns, mean of at least three replicates; bars, SE. The data are represented as
percentage of activity of the treated cells / vehicle cells 100. Data were compared using the unpaired Student’s t test. *, P < 0.05, statistically
significant differences from control. D, the inhibition of the Id-1 gene product by CBD was investigated in MDA-MB436 cells using reverse transcriptionPCR. Expression of the h-actin gene product was used as a control. E, luciferase activity in MDA-MB436 cells transiently transfected with Id-1-sbsluc was
determined in the presence of vehicle (control) or 2 Amol/L of CBD. Cells were treated for 2 d and luciferase activity was measured.
Molecular Cancer Therapeutics 2925
Mol Cancer Ther 2007;6(11). November 2007cancer cell behaviors; (b) partial reduction in Id-1 activity
can achieve significant outcomes; and (c) Id-1 expression is
low in normal adult tissues, thereby eliminating unwanted
toxicities generally associated with currently available therapeutic modalities.
However, approaches targeting Id-1 expression, including gene therapy using antisense oligonucleotide, short
interfering RNA, and nonviral or viral plasmid – based
strategies, are not yet routinely used in the clinic. Therefore,
the development of new strategies to modulate Id-1
expression/functional activity is needed. A range of small
molecules that target the molecular pathology of cancer are
now being developed, and a significant number of them are
being tested in ongoing human clinical trials (17). We
propose that the use of CBD, as an inhibitor of Id-1,
represents a novel strategy to treat breast cancer. A wide
range of cannabinoid compounds were tested and CBD,
a nonpsychoactive cannabinoid constituent, was the most
potent inhibitor of human breast cancer cell aggressiveness
through Id-1 mRNA and protein down-regulation.
Cannabinoid agonists working through CB1 and CB2
receptors have been shown to act as tumor inhibitors in a
variety of cancer models (7, 8). Present evidence also shows
that the cannabinoid constituent CBD, which has negligible
affinity for CB1 and CB2 receptors, also has antitumor
activity (18 – 20). Specifically, Ligresti et al. have recently
shown that CBD inhibits the metastasis of aggressive
human breast cancer cancers in vivo (11). However, the
primary molecular pathways involved in CBD inhibition of
invasion and metastasis remain to be clarified. Overall, the
IC50 values, even being within the range observed by other
laboratories (21, 22), were lower than those reported by
Ligresti et al. (11). This difference is likely due to the fact
that we did the experiments in lower serum concentrations,
which have been shown to improve the antiproliferative
activity of cannabinoids (23).
Here, we report that CBD acting as a potent Id-1 inhibitor
might effectively inhibit genotypic and phenotypic changes
that allow aggressive breast cancers to invade and metastasize. Most importantly, ectopic expression of Id-1 in MDAMB231 breast cancer cells abolished the effects of CBD on cell
invasion. Cells were infected with an Id-1 gene (pLXSN
vector) that is not under the control of the endogenous Id-1
promoter. As presented in Fig. 3, CBD seems to act by downregulating endogenous Id-1 gene expression at the promoter
level, not as a result of mRNA and/or protein destabilization. Therefore, CBD should not have any effect on the Id-1
expression from the pLXSN vector. Indeed, ectopic expression of Id-1 in MDA-MB231 breast cancer cells was able to
abolish the effects of CBD.
These data indicate that Id-1 is a key factor whose
expression needs to be down-regulated in order to observe
the beneficial effects of CBD on the reduction of breast
cancer cell aggressiveness. Based on previous findings
(reviewed in ref. 15), we suggest that a decrease in Id-1
protein upon CBD treatment might consequently lead to a
down-regulation of growth-promoting genes such as
Zfp289 as well as to a down-regulation of invasionpromoting genes such as the membrane type matrix
metalloproteinase (MT1-MMP).
Plant cannabinoids are stable compounds with lowtoxicity profiles that are well tolerated by animals and
humans during chronic administration (24, 25). A formulation including a 1:1 ratio of THC and CBD has recently
been used in a clinical trial for the treatment of multiple
sclerosis (26). The few side effects reported were related to
the psychoactivity of D
9
-THC. If CBD shows efficacy for
treatment of metastatic breast cancer in humans, the low
toxicity of the compound would make it an ideal candidate
for chronic administration.
Because CBD inhibits Id-1 expression in aggressive
breast cancer cells, a rational drug design strategy could
be used to potentially create more potent and efficacious
analogues. Moreover, reducing Id-1 expression with
cannabinoids could also provide a therapeutic strategy
for the treatment of additional aggressive cancers because
Id-1 expression was found to be up-regulated during
the progression of almost all types of solid tumors
investigated (27).
Acknowledgments
The authors thank Dr. Mary Abood for helpful scientific discussions and
the critical reading of the manuscript.
Figure 4. Ectopic expression of Id-1 blocks the effect of CBD on MDAMB231 invasiveness. A, data are presented as relative invasiveness of
control MDA-MB231 cells ( Id-1) and of MDA-MB231 cells that
ectopically expressed Id-1 (+Id-1) after a 2-d treatment with vehicle
(control) or 1.5 Amol/L of CBD (CBD), and then an overnight invasion
assay. The respective controls are set as 100%; columns, mean of at
least three replicates; bars, SE. Data were compared using the unpaired
Student’s t test. *, P < 0.05, statistically significant differences from
control. B, the inhibitory effect of CBD on Id-1 expression in Id-1 and
+Id-1 MDA-MB231 cells was compared using Western analysis. Equal
loading was confirmed by stripping the blots and reprobing with a
monoclonal antitubulin antibody.
2926 Cannabidiol and Id-1 in Breast Cancer
Mol Cancer Ther 2007;6(11). November 2007References
1. Braun S, Harbeck N. Molecular markers of metastasis in breast cancer:
current understanding and prospects for novel diagnosis and prevention.
Expert Rev Mol Med 2001;3:1 – 14.
2. Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub H. The protein
Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell
1990;61:49 – 59.
3. Perk J, Iavarone A, Benezra R. Id family of helix-loop-helix proteins in
cancer. Nat Rev Cancer 2005;5:603 – 14.
4. Fong S, Itahana Y, Sumida T, et al. Id-1 as a molecular target in therapy
for breast cancer cell invasion and metastasis. Proc Natl Acad Sci U S A
2003;100:13543 – 8.
5. Minn AJ, Gupta GP, Siegel PM, et al. Genes that mediate breast cancer
metastasis to lung. Nature 2005;436:518– 24.
6. Pertwee RG. Pharmacology of cannabinoid CB1 and CB2 receptors.
Pharmacol Ther 1997;74:129 – 80.
7. Bifulco M, Di Marzo V. Targeting the endocannabinoid system in
cancer therapy: a call for further research. Nat Med 2002;8:547 – 50.
8. Guzman M. Cannabinoids: potential anticancer agents. Nat Rev Cancer
2003;3:745 – 55.
9. McPartland JM, Russo EB. Cannabis and cannabis extract: greater than
the sum of the parts? J Cannabis Ther 2001;1:103 – 32.
10. Showalter VM, Compton DR, Martin BR, Abood ME. Evaluation of
binding in a transfected cell line expressing a peripheral cannabinoid
receptor (CB2): identification of cannabinoid receptor subtype selective
ligands. J Pharmacol Exp Ther 1996;278:989 – 99.
11. Ligresti A, Moriello AS, Starowicz K, et al. Antitumor activity of plant
cannabinoids with emphasis on the effect of cannabidiol on human breast
carcinoma. J Pharmacol Exp Ther 2006;318:1375 – 87.
12. McAllister SD, Chan C, Taft RJ, et al. Cannabinoids selectively inhibit
proliferation and induce death of cultured human glioblastoma multiforme
cells. J Neurooncol 2005;74:31 – 40.
13. Lin CQ, Singh J, Murata K, et al. A role for Id-1 in the aggressive
phenotype and steroid hormone response of human breast cancer cells.
Cancer Res 2000;60:1332 – 40.
14. Thompson EW, Paik S, Brunner N, et al. Association of increased
basement membrane invasiveness with absence of estrogen receptor and
expression of vimentin in human breast cancer cell lines. J Cell Physiol
1992;150:534 – 44.
15. Fong S, Debs RJ, Desprez PY. Id genes and proteins as promising
targets in cancer therapy. Trends Mol Med 2004;10:387 – 92.
16. Desprez PY, Lin CQ, Thomasset N, Sympson CJ, Bissell MJ, Campisi
J. A novel pathway for mammary epithelial cell invasion induced by the
helix-loop-helix protein Id-1. Mol Cell Biol 1998;18:4577 – 88.
17. Pagliaro L, Felding J, Audouze K, et al. Emerging classes of proteinprotein interaction inhibitors and new tools for their development. Curr
Opin Chem Biol 2004;8:442 – 9.
18. Kogan NM, Rabinowitz R, Levi P, et al. Synthesis and antitumor activity
of quinonoid derivatives of cannabinoids. J Med Chem 2004;47:3800 – 6.
19. Massi P, Vaccani A, Ceruti S, Colombo A, Abbracchio MP, Parolaro D.
Antitumor effects of cannabidiol, a nonpsychoactive cannabinoid, on
human glioma cell lines. J Pharmacol Exp Ther 2004;308:838 – 45.
20. McKallip RJ, Jia W, Schlomer J, Warren JW, Nagarkatti PS,
Nagarkatti M. Cannabidiol-induced apoptosis in human leukemia cells: a
novel role of cannabidiol in the regulation of p22phox and Nox4
expression. Mol Pharmacol 2006;70:897 – 908.
21. Galve-Roperh I, Sanchez C, Cortes ML, del Pulgar TG, Izquierdo M,
Guzman M. Anti-tumoral action of cannabinoids: involvement of sustained
ceramide accumulation and extracellular signal-regulated kinase activation. Nat Med 2000;6:313 – 9.
22. Sanchez C, Galve-Roperh I, Canova C, Brachet P, Guzman M. D9-
Tetrahydrocannabinol induces apoptosis in C6 glioma cells. FEBS Lett
1998;436:6 – 10.
23. Jacobsson SO, Rongard E, Stridh M, Tiger G, Fowler CJ. Serumdependent effects of tamoxifen and cannabinoids upon C6 glioma cell
viability. Biochem Pharmacol 2000;60:1807 – 13.
24. Chandrasekaran R, McAllister SD, Patel SD, Moore DH, Abood ME.
Amyotrophic lateral sclerosis: delayed disease progression in mice by
treatment with a cannabinoid. Amyotroph Lateral Scler Other Motor
Neuron Disord 2004;5:33 – 9.
25. Russo E, Grotenhermen F. Cannabis and cannabinoids: pharmacology, toxicology, and therapeutic potential. The Hawthorne Integrative
Healing Press; 2002.
26. Wade DT, Makela P, Robson P, House H, Bateman C. Do cannabisbased medicinal extracts have general or specific effects on symptoms in
multiple sclerosis? A double-blind, randomized, placebo-controlled study
on 160 patients. Mult Scler 2004;10:434 – 41.
27. Ling MT, Wang X, Zhang X, Wong YC. The multiple roles of Id-1 in
cancer progression. Differentiation 2006;74:481 – 7.
Molecular Cancer Therapeutics 2927
Mol Cancer Ther 2007;6(11). November 2007

Cannabinoids 2006;1(1):10-14 10 © International Association for Cannabis as Medicine

Cannabinoids 2006;1(1):10-14 10  © International Association for Cannabis as Medicine

Mini-review 
Cannabinoids and the Endocannabinoid System  
Franjo Grotenhermen 
nova-Institut, Goldenbergstraße 2, D-50354 Hürth, Germany 
Abstract 
The human body possesses specific binding sites on the surface of many cell types for cannabinoids, and our body produces several endocannabinoids, fatty acid derivatives that bind to these 
cannabinoid receptors (CB) and activate them. CB receptors and endocannabinoids together constitute the endocannabinoid system. Some phytocannabinoids, cannabinoids of the cannabis plant, 
and a multitude of synthetic cannabinoids produced in the laboratory mimic the effects of endocannabinoids. '
9
-THC (dronabinol), the pharmacologically most active cannabinoid of the cannabis plant, binds to both types of cannabinoid receptors that have been identified so far, the CB1 and 
the CB2 receptor. These receptors have been found in the central nervous system (brain and spinal 
cord) and many peripheral tissues and organs. Depending on the kind of cells, on dose and state of 
the body, activation of CB receptors may cause a multitude of effects including euphoria, anxiety, 
dry mouth, muscle relaxation, hunger and pain reduction. Besides activation of CB receptors several other approaches are under investigation to influence the cannabinoid system with therapeutic 
intent, including blockade of CB receptors (antagonism) and modulation of endocannabinoid concentrations by inhibition of their degradation. Currently, several preparations that stimulate cannabinoid receptors (dronabinol, nabilone and cannabis) and one compound that blocks the CB1 receptor (rimonabant) are used medicinally. 
Keywords: Cannabis, THC, cannabinoid, cannabinoid receptor, endocannabinoid, therapeutic use. 
This article can be downloaded, printed and distributed freely for any non-commercial purposes, provided the original work is properly cited (see copyright info below). Available online at www.cannabis-med.org 
Author's address: Franjo Grotenhermen, franjo-grotenhermen@nova-institut.de 
Introduction 
'
9
-tetrahydrocannabinol (THC) is thought to be the 
pharmacologically most active cannabinoid of the 
cannabis plant and its products marijuana (cannabis 
herb) and hashish (cannabis resin). The majority of 
THC effects are mediated through agonistic actions at 
cannabinoid receptors of the human or animal body. 
Agonistic action means that receptors are activated in 
contrast to antagonistic action, i.e. blockade of receptor 
effects.  
Cannabinoid receptors and endocannabinoids, compounds produced by the body that bind to these receptors, together constitute the endocannabinoid system. 
This system is of great importance for the normal function of the body and is millions of years old. It has been 
found in mammals, birds, amphibians, fish, sea urchins, molluscs and leeches. The mechanism of action 
of cannabinoids is best investigated for THC and other 
cannabinoids that bind to known cannabinoid receptors, while the mode of action of other cannabinoids of 
therapeutic interest, among them cannabidiol (CBD), is 
less well established. 
Extended reviews on the issues presented in this short 
article are available at [2,4,5,7,9]. Additional and upto-date information is available from the IACM-Bulletin [8].  
Cannabinoids
Cannabinoids were originally regarded as any of a 
class of typical C21 groups of compounds present in 
Cannabis sativa L.. The modern definition is termed 
with more emphasis on synthetic chemistry and on 
pharmacology, and encompasses kindred structures, or 
any other compound that affects cannabinoid receptors. Grotenhermen 
Cannabinoids Œ Vol 1, No 1 Œ September 17, 2006  11  
O
OH
O
OH
9
8
3
4
5
6
6'
5'
4'
3'
2'
1'
1
3
2
7
3' 5
10b
10
1'
11
9
8
7
13
12
6a
6 5
4
2
1
Monoterpenoid numbering  Dibenzopyran numbering
10
1" 3" 5"
10a
Figure 1. Chemical structure of 
THC (dronabinol), the main 
cannabinoid in the cannabis 
plant, according to the monoterpenoid system ('
1
-THC) and 
dibenzopyran system ('
9
-THC).
This has created several chemical sub-categories that 
take into consideration the various forms of natural and 
synthetic compounds. 
It has been proposed to use the term phytocannabinoid 
for the natural plant compounds and endocannabinoids 
for the natural animal compounds, the endogenous 
ligands of the cannabinoid receptors. Synthetic agonists 
of these receptors have been classified according to 
their degree of kinship (e.g. "classical" vs. "non-classical") with phytocannabinoids.  
Natural plant cannabinoids are oxygen-containing 
aromatic hydrocarbons. In contrast to most other drugs, 
including opiates, cocaine, nicotine and caffeine, they 
do not contain nitrogen, and hence are not alkaloids. 
Phytocannabinoids were originally thought to be only 
present in the cannabis plant (Cannabis sativa L.), but 
recently some cannabinoid type bibenzyls have also 
been found in liverwort (Radula perrottetii and Radula 
marginata). 
More than 60 cannabinoids have been detected in cannabis, mainly belonging to one of 10 subclasses or 
types [3], of whom the cannabigerol type (CBG), the 
cannabichromene type (CBC), the cannabidiol type 
(CBD), the  '
9
-THC type, and the cannabinol type 
(CBN) are the most abundant. Cannabinoid distribution 
varies between different cannabis strains and usually 
only three or four cannabinoids are found in one plant 
in concentrations above 0.1%.  '
9
-THC is largely responsible for the pharmacological effects of cannabis 
including its psychoactive properties, though other 
compounds of the cannabis plant also contribute to 
some of these effects,  especially CBD, a non-psychoactive phytocannabinoid common in some cannabis 
strains that has anti-inflammatory, analgesic, anti-anxiety and anti-psychotic effects. 
11-OH-'
9
-tetrahydrocannabinol (11-OH-THC) is the 
most important psychotropic metabolite of  '
9
-THC 
with a similar spectrum of actions and similar kinetic 
profiles as the parent molecule. 11-nor-9-carboxy-THC 
(THC-COOH) is the most important non-psychotropic 
metabolite of '
9
-THC. 
Cannabinoid Receptors
To date two cannabinoid receptors have been identified, the CB1, and the CB2  receptor.  They  differ  in 
signaling mechanisms and tissue distribution. Activation of cannabinoid receptors causes inhibition of adenylat cyclase, thus inhibiting the conversion of ATP to 
cyclic AMP (cAMP). Other mechanisms have also 
been observed, e.g. interaction with certain ion channels. 
Both CB1 and CB2 receptors belong to the large family 
of the G-protein-coupled receptors (GPCR). GPCRs 
are the most common receptors, containing 1000-2000 
members in vertebrates. Cannabinoid CB1 receptors are 
among the most abundant and widely distributed 
GPCRs in the brain. 
Activation of the CB1  receptor  produces  effects  on 
circulation and psyche common to cannabis ingestion, 
while activation of the CB2  receptor  does  not.  CB1
receptors are mainly found on nerve cells in the brain, 
spinal cord and peripheral nervous system, but are also 
present in certain peripheral organs and tissues, among 
them endocrine glands, salivary glands, leukocytes, 
spleen, heart and parts of the reproductive, urinary and 
gastrointestinal tracts. Many CB1 receptors are expressed at the terminals of central and peripheral 
nerves and inhibit the release of other neurotransmitters. Thus, CB1 receptor activation protects the nervous 
system from over-activation or over-inhibition by neurotransmitters. CB1  receptors  are  highly  expressed  in 
regions of the brain, which are responsible for movement (basal ganglia, cerebellum), memory processing 
(hippocampus, cerebral cortex) and pain modulation 
(certain parts of the spinal  cord, periaqueductal grey), 
while their expression in the brainstem is low, which 
may account for the lack of cannabis-related acute 
fatalities. The brainstem controls, among others, respiration and circulation.  
CB2  receptors  occur  principally  in  immune  cells, 
among them leukocytes, spleen and tonsils. One of the 
functions of CB receptors in the immune system is 
H 
O
OH
Figure 2. Cannabidiol Mini-review 
12  Cannabinoids Œ Vol 1, No 1 Œ September 17, 2006 
N
O
H OH
Figure 3. Arachidonoylethanolamide (AEA, anandamide) 
O
O
OH
CH2
OH
Figure 4. 2-Arachidonoylglycerol (2-AG) 
modulation of release of cytokines, which are responsible for inflammation and regulation of the immune 
system. Since compounds that selectively activate CB2
receptors (CB2  receptor  agonists)  do  not  cause  psychological effects, they have become an increasingly 
investigated target for therapeutic uses of cannabinoids, 
among them analgesic, anti-inflammatory and anticancer actions.  
There is increasing evidence for the existence of additional cannabinoid receptor subtypes in the brain and 
periphery. One of these receptors may be the orphan Gprotein-coupled receptor GPR55 [1]. Other receptors 
may be only functionally related to the known cannabinoid receptors than have a similar structure as CB1
and CB2.  
Endocannabinoids 
The identification of cannabinoid receptors was followed by the detection of endogenous ligands for these 
receptors, named endocannabinoids. In the brain endocannabinoids serve as neuromodulators. All endocannabinoids are derivatives of polyunsaturated fatty acids, thus differing in chemical structure from phytocannabinoids of the cannabis plant. Among the endocannabinoids so far identified are anandamide (N-arachidonoylethanolamide, AEA), 2-arachidonoylglycerol 
(2-AG), 2-arachidonylglyceryl ether (noladin ether), Oarachidonoyl-ethanolamine (virodhamine), and N-arachidonoyl-dopamine (NADA). Anandamide and 
NADA do not only bind to cannabinoid receptors but 
also share the ability of capsaicin, a constituent of hot 
chilli peppers, to stimulate vanilloid (TRPV1) receptors. 
The first two discovered endocannabinoids, anandamide and 2-AG, have been most studied. In contrast 
to other brain chemical signals they are not produced 
and stored in the nerve cells but produced `on demanda 
(only when necessary) from their precursors and then 
released from cells. After release, they are rapidly  
deactivated by uptake into cells and metabolized. Metabolism of anandamide and 2-AG occurs mainly by 
enzymatic hydrolysis by fatty acid amide hydrolase 
(FAAH) and monoacylglycerol lipase (2-AG only).  
Affinity for the Cannabinoid Receptor 
Cannabinoids show different affinity to CB1  and  CB2
receptors. Synthetic cannabinoids have been developed 
that act as highly selective  agonists or antagonists at 
one or other of these receptor types. '
9
-THC has approximately equal affinity for the CB1  and  CB2  receptor, while anandamide has marginal selectivity for 
CB1  receptors.  However,  the  efficacy  of  THC  and 
anandamide is less at CB2 than at CB1 receptors.  
Tonic Activity of the Endocannabinoid System 
When administered by themselves antagonists at the 
cannabinoid receptor may behave as inverse agonists in 
several bioassay systems. This means that they do not 
only block the effects of endocannabinoids but produce 
effects that are opposite  in direction from those produced by cannabinoid receptor agonists, e.g. cause 
increased sensitivity to pain or nausea, suggesting that 
the cannabinoid system is tonically active. This tonic 
activity may be due a constant release of endocannabinoids or from a portion of cannabinoid receptors that 
exist in a constitutively active state. 
Tonic activity of the cannabinoid system has been 
demonstrated in several conditions. Endocannabinoid 
levels have been demonstrated to be increased in a pain 
circuit of the brain (periaqueductal grey) following 
painful stimuli. Tonic control of spasticity by the endocannabinoid system has been observed in chronic relapsing experimental autoimmune encephalomyelitis 
(CREAE) in mice, an animal model of multiple sclerosis. An increase of cannabinoid receptors following 
nerve damage was demonstrated in a rat model of 
chronic neuropathic pain and in a mouse model of 
intestinal inflammation. This may increase the potency 
of cannabinoid agonists used for the treatment of these 
conditions. Tonic activity has also been demonstrated 
with regard to appetite control and with regard to vomiting in emetic circuits of the brain. 
  
Therapeutic Prospects 
Mechanisms of action of cannabinoids are complex, 
not only involving activation of and interaction at the 
cannabinoid receptor, but also activation of vanilloid 
receptors, increase of endocannabinoid concentration, 
antioxidant activity, metabolic interaction with other 
compounds, and several others. CB receptor antagonists (blockers) are in clinical use for the treatment of 
obesity and under investigation for the treatment of 
nicotine and other dependencies. 
Aside from phytocannabinoids and cannabis preparations, cannabinoid analogues that do not or only 
weakly bind to the CB1  receptor  are  attractive  com- Grotenhermen 
Cannabinoids Œ Vol 1, No 1 Œ September 17, 2006  13
O
O
OH
Figure 5. Nabilone 
O 
OH
COOH 
Figure 6. CT3 (ajulemic acid, IP751) 
OH
O
O
HOOC O
Figure 7. Cannabinor 
N
N
Cl
Cl
Cl
H-N
N
O
Figure 8. Rimonabant (SR 141716A), Aclompia® 
pounds for clinical research. Additional ideas for the 
separation of the desired therapeutic effects from the 
psychotropic action comprise the concurrent administration of THC and CBD, the design of CB1 receptor 
agonists that do not cross the blood brain barrier, and 
the development of compounds that influence endocannabinoid levels by inhibition of their membrane 
transport (transport inhibitors) or hydrolysis (e.g. 
FAAH inhibitors). For example, blockers of anandamide hydrolysis were able to reduce among others, 
anxiety, pain, cancer growth, and colitis in animal tests. 
Drugs that enhance the response of the CB1 receptor to 
endogenously released endocannabinoids by binding to 
the so-called allosteric site  on  this  receptor  are  also 
likely to be more selective than compounds that activate this receptor directly [10]. 
Modulators of the cannabinoid system in clinical 
use and under investigation 
Currently two cannabinoid receptor agonists, dronabinol and nabilone, a cannabis extract (Sativex®), and a 
cannabinoid receptor antagonist (rimonabant) are in 
medical use. In addition, cannabis herb produced according to pharmaceutical standards and supervised by 
the Office of Medicinal Cannabis of the Dutch Health 
Ministry is available in pharmacies of the Netherlands 
[4]. In some countries the possession of small amounts 
of cannabis either for recreational or medicinal use is 
allowed or tolerated, such as in the Netherlands, Spain, 
Belgium and some regions of Switzerland. Eleven 
states of the USA (Alaska,  California,  Colorado,  Hawaii, Maine, Montana, Nevada, Oregon, Rhode Island, 
Vermont, Washington) have legalized the medical use 
of cannabis under state law, while it remains illegal 
under federal law. In Canada it is possible to apply for 
a certificate of exemption to use otherwise illegal cannabis for medical purposes, and the Health Ministry 
(Health Canada) sells cannabis herb to these patients if 
they do not want to grow it themselves. 
Dronabinol is the international non-proprietary name 
(INN) for  '
9
-THC, the main psychoactive compound 
of cannabis. In 1985 the Food and Drug Administration 
(FDA) of the United States approved Marinol® Capsules, which contain synthetic dronabinol (2.5 mg, 5 
mg or 10 mg), for nausea and vomiting associated with 
cancer chemotherapy in patients that had failed to respond adequately to conventional anti-emetic treatments. Marinol® is manufactured by Unimed Pharmaceuticals, a subsidiary of  Solvay  Pharmaceuticals. 
Marinol® has been on the market in the USA since 
1987. In 1992 the FDA approved Marinol® Capsules 
for the treatment of anorexia  associated  with  weight 
loss in patients with AIDS. Marinol is also available on 
prescription in several other countries including Canada and several European countries. In Germany and 
Austria dronabinol, which is manufactured by the two 
German companies THC Pharm and Delta 9 Pharma, 
may be bought by pharmacies to produce dronabinol 
capsules or solutions. 
In 1985 the FDA also approved Cesamet® Capsules 
for the treatment of nausea  and  vomiting  associated 
with chemotherapy. Cesamet® made by Eli Lilly and 
Company contains nabilone, a synthetic derivative of 
dronabinol. However, it was not marketed in the USA 
and Lilly discontinued the drug in 1989. Cesamet® is 
also available in the United Kingdom marketed by Mini-review 
14  Cannabinoids Œ Vol 1, No 1 Œ September 17, 2006 
Cambridge Laboratories and in several other European 
countries. In 2006 nabilone (Cesamet®) again got 
approval by the FDA as a  prescription treatment for 
nausea and vomiting associated with chemotherapy. It 
is marketed by Valeant Pharmaceuticals International, 
which bought the drug from Eli Lilly in 2004 and also 
sells it in Canada. 
In 2005 Sativex® received approval in Canada for the 
symptomatic relief of neuropathic pain in multiple 
sclerosis. Sativex® is produced by the British company 
GW Pharmaceuticals and marketed in Canada by Bayer 
Health Care. Sativex® is a cannabis extract, which is 
sprayed in the oromucosal area and contains approximately equal amounts of dronabinol (THC) and cannabidiol (CBD). There is also limited access to Sativex® in the UK and Spain. Sativex is currently under 
review for approval as a prescription medication for 
treatment of spasticity in multiple sclerosis in the 
United Kingdom, Spain, Denmark and the Netherlands.  
The cannabinoid receptor antagonist rimonabant received a positive recommendation for approval by the 
European Medicines Agency in 2006. It is available in 
the United Kingdom under the trade name Acomplia® 
for the treatment of obesity. Acomplia® tablets contain 
20 mg of rimonabant. The drug is manufactured by 
Sanofi Aventis.  
Preparations under investigation in clinical phase II or 
III studies include the capsulated cannabis extract Cannador®, which contains dronabinol and other cannabinoids in a ratio of 2 to 1 and is being investigated by 
the Institute for Clinical Research in Berlin and the 
pharmaceutical company Weleda, ajulemic acid, a 
synthetic derivative of THC-COOH, which is also 
called CT3 or IP751 and is being investigated by Indevus Pharmaceuticals, and cannabinor, a synthetic cannabinoid that binds selectively to the CB2 receptor and 
is being investigated by Pharmos Corporation. 
References 
1. Baker D, Pryce G, Davies WL, Hiley CR. In 
silico patent searching reveals a new cannabinoid 
receptor. Trends Pharmacol Sci 2006;27(1):1-4. 
2. Di Marzo V, De Petrocellis L. Plant, synthetic, 
and endogenous cannabinoids in medicine. Annu 
Rev Med 2006;57:553-74. 
3. ElSohly M. Chemical constituents of cannabis. 
In: Grotenhermen F, Russo E, editors. Cannabis 
and cannabinoids. Pharmacology, toxicology, and 
therapeutic potential. Binghamton/New York: 
Haworth Press, 2002. p. 27-36. 
4. Grotenhermen F. Cannabinoids. Curr Drug Targets CNS Neurol Disord 2005;4(5):507-530. 
5. Grotenhermen F. Clinical  pharmacodynamics  of 
cannabinoids. In: Russo E, Grotenhermen F, editors. The Handbook of Cannabis Therapeutics: 
From Bench to Bedside. Binghamton/New York: 
Haworth Press, 2006. p. 117-170.  
6. Hazekamp A. An evaluation of the quality of 
medicinal grade cannabis in the Netherlands. 
Cannabinoids 2006;1(1):1-9. 
7. Howlett AC, Barth F, Bonner TI, Cabral G, 
Casellas P, Devane WA, Felder CC, Herkenham 
M, Mackie K, Martin BR, Mechoulam R, 
Pertwee RG. International Union of Pharmacology. XXVII. Classification of cannabinoid receptors. Pharmacol Rev 2002;54(2):161-202. 
8. IACM-Bulletin. Bulletin of the International 
Association for Cannabis as Medicine. Available 
from: http://www.cannabismed.org/english/bulletin/iacm.php. 
9. Pertwee R. Receptors and pharmacodynamics: 
natural and synthetic cannabionoids and endocannabinoids. In: Guy GW, Whittle B, Robson P, 
editors. The Medicinal Uses of Cannabis and 
Cannabinoids. London, Chicago: Pharmaceutical 
Press; 2004. p. 103-139. 
10. Price MR, Baillie GL, Thomas A, Stevenson LA, 
Easson M, Goodwin R, McLean A, McIntosh L, 
Goodwin G, Walker G, Westwood P, Marrs J, 
Thomson F, Cowley P, Christopoulos A, Pertwee 
RG, Ross RA. Allosteric modulation of the cannabinoid CB1  receptor.  Mol  Pharmacol 
2005;68(5):1484-95. 

A Molecular Link between the Active Component of Marijuana and Alzheimer’s Disease Pathology Lisa M. Eubanks,

A Molecular Link between the Active Component ofMarijuana and Alzheimer’s Disease PathologyLisa M. Eubanks,†Claude J. Rogers,†Albert E. Beuscher IV,‡George F. Koob,§Arthur J. Olson,‡Tobin J. Dickerson,†and Kim D. Janda*,†Departments of Chemistry, Immunology, and Molecular Biology, Molecular andIntegrated Neurosciences Department, The Skaggs Institute for Chemical Biology, andWorm Institute for Research and Medicine, The Scripps Research Institute,10550 North Torrey Pines Road, La Jolla, California 92037Received June 11, 2006Abstract: Alzheimer’s disease is the leading cause of dementia among the elderly, and withthe ever-increasing size of this population, cases of Alzheimer’s disease are expected to tripleover the next 50 years. Consequently, the development of treatments that slow or halt the diseaseprogression have become imperative to both improve the quality of life for patients and reducethe health care costs attributable to Alzheimer’s disease. Here, we demonstrate that the activecomponent of marijuana, ¢9-tetrahydrocannabinol (THC), competitively inhibits the enzymeacetylcholinesterase (AChE) as well as prevents AChE-induced amyloid â-peptide (Aâ)aggregation, the key pathological marker of Alzheimer’s disease. Computational modeling ofthe THC-AChE interaction revealed that THC binds in the peripheral anionic site of AChE, thecritical region involved in amyloidgenesis. Compared to currently approved drugs prescribedfor the treatment of Alzheimer’s disease, THC is a considerably superior inhibitor of Aâaggregation, and this study provides a previously unrecognized molecular mechanism throughwhich cannabinoid molecules may directly impact the progression of this debilitating disease.Keywords: Cannabinoids; Alzheimer’s disease; acetylcholinesteraseIntroductionSince the characterization of the Cannabis satiVa producedcannabinoid, ¢9-tetrahydrocannabinol (THC) (Figure 1), inthe 1960s,1this natural product has been widely explored asan antiemetic, anticonvulsive, anti-inflammatory, and analgesic.2In these contexts, efficacy results from THC bindingto the family of cannabinoid receptors found primarily oncentral and peripheral neurons (CB1) or immune cells (CB2).3More recently, a link between the endocannabinoid systemand Alzheimer’s disease has been discovered4which hasprovided a new therapeutic target for the treatment of patientssuffering from Alzheimer’s disease.5New targets for this* Author to whom correspondence should be addressed. Mailingaddress: Department of Chemistry, The Scripps ResearchInstitute and the Skaggs Institute for Chemical Biology, 10550North Torrey Pines Rd., La Jolla, CA 92037. Tel: 858-784-2515. Fax: 858-784-2595. E-mail: kdjanda@scripps.edu.†Departments of Chemistry and Immunology, The Skaggs Institutefor Chemical Biology, and Worm Institute for Research andMedicine (WIRM).‡Department of Molecular Biology.§Molecular and Integrated Neurosciences Department (MIND).(1) Gaoni, Y.; Mechoulam, R. Isolation, structure, and partial synthesisof an active constituent of hashish. J. Am. Chem. Soc. 1964, 86,1646-1650.(2) Carlini, E. A. The good and the bad effects of (-) trans-delta-9-tetrahydrocannabinol (¢9-THC) on humans. Toxicon 2004, 44,461-467.Figure 1. Chemical structure of ¢9-tetrahydrocannabinol(THC).brief articles10.1021/mp060066m CCC: $33.50 © XXXX American Chemical Society VOL. XXXX NO. XXXX MOLECULAR PHARMACEUTICS APublished on Web 08/09/2006 PAGE EST: 4.6debilitating disease are critical as Alzheimer’s disease afflictsover 20 million people worldwide, with the number ofdiagnosed cases continuing to rise at an exponential rate.6,7These studies have demonstrated the ability of cannabinoidsto provide neuroprotection against â-amyloid peptide (Aâ)toxicity.8-10Yet, it is important to note that, in these reports,cannabinoids serve as signaling molecules which regulatedownstream events implicated in Alzheimer’s disease pathology and are not directly implicated as effecting Aâ at amolecular level.One of the primary neuropathological hallmarks of Alzheimer’s disease is deposition of Aâ into amyloid plaquesin areas of the brain important for memory and cognition.11Over the last two decades, the etiology of Alzheimer’sdisease has been elucidated through extensive biochemicaland neurobiological studies, leading to an assortment ofpossible therapeutic strategies including prevention of downstream neurotoxic events, interference with Aâ metabolism,and reduction of damage from oxidative stress and inflammation.12The impairment of the cholinergic system is themost dramatic of the neurotransmitter systems affected byAlzheimer’s disease and, as a result, has been thoroughlyinvestigated. Currently, there are four FDA-approved drugsthat treat the symptoms of Alzheimer’s disease by inhibitingthe active site of acetylcholinesterase (AChE), the enzymeresponsible for the degradation of acetylcholine, therebyraising the levels of neurotransmitter in the synaptic cleft.13In addition, AChE has been shown to play a further role inAlzheimer’s disease by acting as a molecular chaperone,accelerating the formation of amyloid fibrils in the brain andforming stable complexes with Aâ at a region known as theperipheral anionic binding site (PAS).14,15Evidence supporting this theory was provided by studies demonstrating thatthe PAS ligand, propidium, is able to prevent amyloidacceleration in vitro, whereas active-site inhibitors had noeffect.16Due to the association between the AChE PAS andAlzheimer’s disease, a number of studies have focused onblocking this allosteric site.17Recently, we reported acombined computational and experimental approach toidentify compounds containing rigid, aromatic scaffoldshypothesized to disrupt protein-protein interactions.18-20Similarly, THC is highly lipophilic in nature and possessesa fused tricyclic structure. Thus, we hypothesized that thisterpenoid also could bind to the allosteric PAS of AChE withconcomitant prevention of AChE-promoted Aâ aggregation.Experimental SectionDocking Procedures. THC was docked to the mouseAChE structure (PDB ID code 1J07) using AutoDock 3.0.5.21Twenty docking runs (100 million energy evaluations each)were run with a 26.25 Å 18.75 Å 26.25 Å grid box(3) Howlett, A. C.; Barth F.; Bonner, T. I.; Cabral, G.; Casellas P.;Devane, W. A.; Felder, C. C.; Herkenham, M.; Mackie, K.;Martin, B. R.; Mechoulam, R.; Pertwee, R. G. International Unionof Pharmacology. XXVII. Classification of cannabinoid receptors.Pharmacol. ReV. 2002, 54, 161-202.(4) Benito, C.; Nunez, E.; Tolon, R. M.; Carrier, E. J.; Rabano, A.;Hillard, C. J.; Romero, J. Cannabinoid CB2 receptors and fattyacid amide hydrolase are selectively overexpressed in neuriticplaque-associated glia in Alzheimer’s disease brains. J. Neurosci.2003, 23, 11136-11141.(5) Pazos, M. R.; Nu´n˜ez, E.; Benito, C.; Tolo´n, R. M.; Romero, J.Role of the endocannabinoid system in Alzheimer’s disease: newperspectives. Life Sci. 2004, 75, 1907-1915.(6) Ritchie, K.; Kildea, D. Is senile dementia “age-related” or “ageingrelated”?sevidence from meta-analysis of dementia prevalencein the oldest old. Lancet 1995, 346, 931-934.(7) Evans, D. A. Estimated prevalence of Alzheimer’s disease in theUnited States. Milbank Q. 1990, 68, 267-289.(8) Milton, N. G. Anandamide and noladin ether prevent neurotoxicityof the human amyloid-â peptide. Neurosci. Lett. 2002, 332, 127-130.(9) Iuvone, T.; Esposito, R.; Santamaria, R.; Di Rosa, M.; Izzo, A.A. Neuroprotective effect of cannabidiol, a non-psychoactivecomponent from Cannabis sativa, on beta-amyloid-induced toxicity in PC12 cells. J. Neurochem. 2004, 89, 134-141.(10) Ramı´rez, B. G.; Bla´zquez, C.; Go´mez del Pulgar, T.; Guzma´n,M.; de Ceballos, M. L. Prevention of Alzheimer’s diseasepathology by cannabinoids: neuroprotection mediated by blockadeof microglial activation. J. Neurosci. 2005, 25, 1904-1913.(11) Rozemuller, J. M.; Eikelenboom, P.; Stam, F. C.; Beyreuther, K.;Masters, C. L. A4 protein in Alzheimer’s disease: primary andsecondary cellular events in extracellular amyloid deposition. J.Neuropathol. Exp. Neurol. 1989, 48, 674-691.(12) Bachurin, S. O. Medicinal chemistry approaches for the treatmentand prevention of Alzheimer’s disease. Med. Res. ReV. 2003, 23,48-88.(13) Racchi, M.; Mazzucchelli, M.; Porrello, E.; Lanni, C.; Govoni,S. Acetylcholinesterase inhibitors: novel activities of old molecules. Pharmacol. Res. 2004, 50, 441-451.(14) Inestrosa, N. C.; Alvarez, A.; Pecez, C. A.; Moreno, R. D.;Vicente, M.; Linker, C.; Casanueva, O. I.; Soto, C.; Garrido, J.Acetylcholinesterase accelerates assembly of amyloid-â-peptidesinto Alzheimer’s fibrils: possible role of the peripheral site ofthe enzyme. Neuron 1996, 16, 881-891.(15) Alvarez, A.; Alarcon, A.; Opazo, C.; Campos, E. O.; Munoz, F.J.; Calderon, F. H.; Dajas, F.; Gentry, M. K.; Doctor, B. P.; DeMello, F. G.; Inestrosa, N. C. Stable complexes involvingacetylcholinesterase and amyloid-â peptide change the biochemical properties of the enzyme and increase the neurotoxicity ofAlzheimer’s fibrils. J. Neurosci. 1998, 18, 3213-3223.(16) Bartolini, M.; Bertucci, C.; Cavrini, V.; Andrisano, V. â-Amyloidaggregation induced by human acetylcholinesterase: inhibitionstudies. Biochem. Pharmacol. 2003, 65, 407-416.(17) Johnson, G.; Moore, S. W. The peripheral anionic site ofacetylcholinesterase: structure, functions and potential role inrational drug design. Curr. Pharm. Des. 2006, 12, 217-225.(18) Dickerson, T. J.; Beuscher, A. E., IV; Rogers, C. J.; Hixon, M.S.; Yamamoto, N.; Xu, Y.; Olson, A. J.; Janda, K. D. Discoveryof acetylcholinesterase peripheral anionic site ligands throughcomputational refinement of a directed library. Biochemistry 2005,44, 14845-14853.(19) Xu, Y.; Shi, J.; Yamamoto, N.; Moss, J. A.; Vogt, P. K.; Janda,K. D. A credit-card library approach for disrupting protein-proteininteractions. Bioorg. Med. Chem. 2006, 14, 2660-2673.(20) Xu, Y.; Lu, H.; Kennedy, J. P.; Yan, X.; McAllister, L. A.;Yamamoto, N.; Moss, J. A.; Boldt, G. E.; Jiang, S.; Janda, K. D.Evaluation of “credit card” libraries for inhibition of HIV-1 gp41fusogenic core formation. J. Comb. Chem. 2006, 8, 531-539.brief articles Eubanks et al.B MOLECULAR PHARMACEUTICS VOL. XXXX NO. XXXXwith 0.375 Å grid spacing. This grid box was designed toinclude regions of both the catalytic site and the peripheralanionic site. Otherwise, standard docking settings were usedfor the AutoDock calculations, as previously detailed.18Acetylcholinesterase Inhibition Studies. All assays wereperformed using a Cary 50 Bio UV-visible spectrophotometer using an 18-cell changer, and conducted at 37 °C, usinga Cary PCB 150 water Peltier system. Solutions of acetylthiocholine iodide (ATCh iodide) and 5,5′-dithiobis(2-nitrobenzoic) acid (DTNB) were prepared according to themethod of Ellman et al.22Stock solutions of acetylcholinesterase from Electrophorus electricus were prepared bydissolving commercially available enzyme in 1% gelatin.Prior to use, an aliquot of the gelatin solution was diluted1:200 in water. For the assay, the solution was diluted untilenzyme activity between 0.1 and 0.13 AU/min at 500 íMACTh iodide was obtained. Compounds were prepared assolutions in methanol.Assays were performed by mixing AChE, THC, and 340íM DTNB in 100 mM phosphate buffer, pH 8.0, containing5% methanol. Solutions were incubated at 37 °C for 5 minbefore the reaction was initiated by the addition of ATChiodide (75-300 íM). The increase of absorbance at 412 nmwas monitored for 2-5 min. All assays were run in triplicate.Initial rates were determined by subtracting the averageobserved initial rate from the nonenzymatic reaction.Linear regression analysis of reciprocal plots of 1/Vo versus1/[S] for four THC concentrations was performed usingMicrosoft Excel software. The slope was plotted against [I]to give Ki values. Propagation of error was performed todetermine the error, ¢Ki.For studies to determine the mutual exclusivity of THCand propidium iodide, experiments were performed identically to THC inhibition studies with a fixed concentrationof ACTh iodide (125 íM), and varied concentrations ofpropidium iodide (0-25 íM) and THC (0-15 íM).AChE-Induced â-Amyloid Peptide Aggregation in thePresence of AChE Ligands. The aggregation of the â-amyloid peptide was measured using the thioflavin T basedfluorometric assay as described by LeVine23and Bartolini.16Assays were measured using a SpectraMAX Gemini fluorescence plate reader with SOFTmax PRO 2.6.1 software.Aâ1-40 stock solutions were prepared in DMSO and HuAChEstocks prepared in distilled water. All stock solutions of Aâand HuAChE were used immediately after preparation.In a 96-well plate, triplicate samples of a 20 íL solutionof 23 nM Aâ, 2.30 íM HuAChE, and various concentrationsof THC in 0.215 M sodium phosphate buffer, pH 8.0, wereprepared. These solutions were incubated at room temperature along with triplicate solutions of Aâ alone, Aâ withAChE, and Aâ with varying concentrations of THC. After48 h, a 2 íL aliquot was removed from each well, placed ina black-walled, clear-bottomed 96-well plate, and dilutedwith 50 mM glycine-NaOH buffer, pH 8.5, containing 1.5íM thioflavin T to a total volume of 200 íL. After incubationfor 5 min, the fluorescence was measured using ìexc ) 446nm and ìem ) 490 nm with excitation and emission slits of2 nm. The fluorescence emission spectrum was recordedbetween 450 and 600 nm, with excitation at 446 nm.The fluorescence intensities were averaged, and theaverage background fluorescence of buffer only, or bufferand THC, was subtracted. The corrected fluorescence valueswere plotted with their standard deviation. The equation, Fi/Fo 100%, where Fiis the fluorescence of AChE, Aâ, andTHC, and Fo is the fluorescence of AChE and Aâ, was usedto quantify the extent to which each compound inhibits Aâaggregation. The Student’s t-test function of Microsoft Excelwas used to determine p values and assess statisticalsignificance between reactions.Control experiments containing AChE, THC, and thioflavin T or AChE and thioflavin T alone were also performedto ensure that any observed fluorescence decrease was notattributable to the molecular rotor properties of thioflavin Tupon binding to AChE. For these reactions, all concentrationswere identical to those used in the described Aâ aggregationassays (vide supra).Results and DiscussionTHC binding to AChE initially was modeled in silico usingAutoDock 3.0.5.21Twenty docking runs with 100 millionenergy evaluations each were performed with a 26.25 Å 18.75 Å 26.25 Å grid box with 0.375 Å grid spacing,which included regions of both the catalytic site and the PAS.Examination of the docking results revealed that THC was(21) Morris, G. M.; Goodsell, D. S.; Halliday, R. S.; Huey, R.; Hart,W. E.; Belew, R. K.; Olson, A. J. Automated docking using aLamarckian genetic algorithm and an empirical binding freeenergy function. J. Comput. Chem. 1998, 19, 1639-1662.(22) Ellman, G. L.; Courtney, K. D.; Andres, Jr., V.; Featherstone, R.M. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 1961, 7, 88-95.(23) LeVine, H., III. Thioflavine T interaction with synthetic Alzheimer’s disease â-amyloid peptides: detection of amyloidaggregation in solution. Protein Sci. 1993, 2, 404-410.Figure 2. Predicted binding mode of THC (gray) to AChE(orange ribbon). The catalytic triad residues of AChE (green)and water molecules included in the docking calculations (lightblue spheres) are shown.Marijuana and Alzheimer’s Disease Pathology brief articlesVOL. XXXX NO. XXXX MOLECULAR PHARMACEUTICS Cpredicted to bind to AChE with comparable affinity to thebest reported PAS binders, with the primary binding interaction observed between the ABC fused ring of the THCscaffold and the Trp86 indole side chain of AChE (Figure2). Further interactions were also evident between THC andthe backbone carbonyls of Phe123 and Ser125. Encouragedby these results, we tested the ability of THC to inhibit AChEcatalytic activity. Steady-state kinetic analysis of THCinhibition revealed that THC competitively inhibits AChE(Ki ) 10.2 íM) (Figure 3A). This level of inhibition isrelatively modest, yet it is important to note that inhibitionof acetylcholine cleavage is not a prerequisite for effectivereduction of Aâ aggregation; indeed, most PAS binders aremoderate AChE inhibitors displaying either noncompetitiveor mixed-type inhibition.16While THC shows competitiveinhibition relative to the substrate, this does not necessitatea direct interaction between THC and the AChE active site.In fact, given the proximity of the PAS to the protein channelleading to the catalytic triad active site, it is possible to blocksubstrate entry into the active site while bound to the PAS,thus preventing the formation of an ESI complex.18,24In orderto test this hypothesis, additional kinetic experiments wereperformed to determine the mutual exclusivity of THC andpropidium, a well-characterized purely noncompetitive AChEinhibitor and PAS binder. Dixon plots of V-1versus THCconcentration at different fixed concentrations of propidiumreturned a series of parallel lines, indicating that THC andpropidium cannot bind simultaneously to AChE (Figure 3B).Thus, these studies verify our docking results and demonstrate that THC and propidium are mutually exclusive PASinhibitors. Additionally, recent reports have suggested thatthe selectivity of a given inhibitor for AChE over butyrylcholinesterase (BuChE) can be correlated with the ability ofa compound to block AChE-accelerated Aâ aggregation.25,26Kinetic examination of BuChE inhibition revealed a slightreduction in enzymatic activity at high concentrations of THC(IC50 g 100 íM); however, these experiments were limitedby the poor solubility of THC in aqueous solution.The activity of THC toward the inhibition of Aâ aggregation was then investigated using a thioflavin T (ThT) basedfluorometric assay to stain putative Aâ fibrils.23Using thisassay, we found that THC is an effective inhibitor of theamyloidogenic effect of AChE (Figure 4). In fact, at aconcentration of 50 íM, propidium does not fully preventAChE-induced aggregation (p ) 0.03, Student’s t test), whileTHC completely blocks the AChE effect on Aâ aggregation,with significantly greater inhibition than propidium (p )0.04, Student’s t test), one of the most effective aggregationinhibitors reported to date.16However, the observed decreasein fluorescence could also be rationalized as a result of acompetition between THC and ThT for the same site onAChE. It has been shown that ThT also can bind to the PASand that this binding leads to an increase in fluorescence.Presumably, this phenomenon results from ThT serving asa molecular rotor in which fluorescence quantum yield issensitive to the intrinsic rotational relaxation; thus, whenmolecular rotation is slowed by protein binding, the quantum(24) Szegletes, T.; Mallender, W. D.; Rosenberry, T. L. Nonequilibriumanalysis alters the mechanistic interpretation of inhibition ofacetylcholinesterase by peripheral site ligands. Biochemistry 1998,37, 4206-4216.(25) Piazzi, L.; Rampa, A.; Bisi, A.; Gobbi, S.; Belluti, F.; Cavalli,A.; Bartolini, M.; Andrisano, V.; Valenti, P.; Recanatini, M. 3-(4-{[Benzyl(methyl)amino]methyl}-phenyl)-6,7-dimethoxy-2H-2-chromenone (AP2238) inhibits both acetylcholinesterase andacetylcholinesterase-induced â-amyloid aggregation: A dualfunction lead for Alzheimer’s disease therapy. J. Med. Chem.2003, 46, 2279-2282.(26) Belluti, F.; Rampa, A.; Piazzi, L.; Bisi, A.; Gobbi, S.; Bartolini,M.; Andrisano, V.; Cavalli, A.; Recanatini, M.; Valenti, P.Cholinesterase inhibitors: Xanthostigmine derivatives blockingthe acetylcholinesterase-induced â-amyloid aggregation. J. Med.Chem. 2005, 48, 4444-4456.Figure 3. (A) Kinetic analysis of AChE inhibition by THC: 0 (b), 6.25 (2), 12.5 ([), and 25.0 íM (9). Steady-state kineticanalysis was performed using acetylthiocholine (75-300 íM) and Ellman’s reagent (340 íM) at 37 °C. (B) Dixon plots of 1/vversus [THC] at different fixed concentrations of propidium iodide: 0 (b), 6.25 (2), 12.5 ([), and 25 íM (9).brief articles Eubanks et al.D MOLECULAR PHARMACEUTICS VOL. XXXX NO. XXXXyield of the molecule can increase dramatically.27,28In orderto ensure that the observed fluorescence decrease was dueto fibril inhibition, control experiments were performed usingAChE, THC, and ThT. Reactions containing AChE and ThTalone showed the same fluorescence output as those containing AChE, THC, and ThT, providing convincing evidencethat any observed reduction in fluorescence can be attributedto fewer Aâ fibrils.ConclusionWe have demonstrated that THC competitively inhibitsAChE and, furthermore, binds to the AChE PAS anddiminishes Aâ aggregation. In contrast to previous studiesaimed at utilizing cannabinoids in Alzheimer’s diseasetherapy,8-10our results provide a mechanism whereby theTHC molecule can directly impact Alzheimer’s diseasepathology. We note that while THC provides an interestingAlzheimer’s disease drug lead, it is a psychoactive compoundwith strong affinity for endogenous cannabinoid receptors.It is noteworthy that THC is a considerably more effectiveinhibitor of AChE-induced Aâ deposition than the approveddrugs for Alzheimer’s disease treatment, donepezil andtacrine, which reduced Aâ aggregation by only 22% and 7%,respectively, at twice the concentration used in our studies.7Therefore, AChE inhibitors such as THC and its analoguesmay provide an improved therapeutic for Alzheimer’sdisease, augmenting acetylcholine levels by preventingneurotransmitter degradation and reducing Aâ aggregation,thereby simultaneously treating both the symptoms andprogression of Alzheimer’s disease.Acknowledgment. This work was supported by theSkaggs Institute for Chemical Biology and a NIH KirschsteinNational Research Service Award to L.M.E.MP060066M(27) De Ferrari, G. V.; Mallender, W. D.; Inestrosa, N. C.; Rosenberry,T. L. Thioflavin T is a fluorescent probe of the acetylcholinesteraseperipheral site that reveals conformational interactions betweenthe peripheral and acylation sites. J. Biol. Chem. 2001, 276,23282-23287.(28) Viriot, M. L.; Carre, M. C.; Geoffroy-Chapotot, C.; Brembilla,A.; Muller, S.; Stoltz, J. F. Molecular rotors as fluorescent probesfor biological studies. Clin. Hemorheol. Microcirc. 1998, 19, 151-160.Figure 4. Inhibition of AChE-induced Aâ aggregation by THCand propidium ((*) p < 0.05 versus Aâ only; (#) p < 0.05versus Aâ + propidium).Marijuana and Alzheimer’s Disease Pathology brief articlesPAGE EST: 4.6 VOL. XXXX NO. XXXX MOLECULAR PHARMACEUTICS E

Η κάνναβη είναι το κλειδί για την καλή υγεία που τρώμε εναντίον καπνός είναι

Η κάνναβη είναι το κλειδί για την καλή υγεία που τρώμε εναντίον καπνός είναι

JOE MARTINO 3 ΙΑΝΟΥΑΡΊΟΥ 2013 31

Δεν είναι μυστικό ότι ο κόσμος μας έχει δει μια τεράστια αύξηση σε κακή υγεία και περιπτώσεων καρκίνου. Πρέπει να αποτελέσει καμία έκπληξη όταν κοιτάξουμε τι τρώμε καθημερινά, η κατάσταση του περιβάλλοντος μας και τα είδη των προϊόντων περιποίησης σώματος που χρησιμοποιούμε καθημερινά περιέχουν ότι ένας τόνος του καρκίνου παράγοντες που προκαλούν. Mainstream ιατρική υποδηλώνει ότι η χημειοθεραπεία και η ακτινοβολία είναι ο καλύτερος τρόπος να πάει για τη θεραπεία του καρκίνου, αλλά υπάρχει ένα αυξανόμενο σώμα της στοιχεία που να δείχνουν υπάρχουν πολύ καλύτερες θεραπείες.

Κανναβινοειδή μπορεί κάλλιστα να είναι ένα από τα καλύτερα της νόσου και την καταπολέμηση του καρκίνου θεραπείες εκεί έξω. Αν έχετε ακούσει για Rick Simpson έχετε ακούσει για τις μεθόδους του για την προετοιμασία κάνναβη με τέτοιο τρόπο, όπου είναι σε θέση να εξάγει το λάδι από αυτό και να χρησιμοποιεί το εν λόγω λάδι για τη θεραπεία του καρκίνου. Rick ήταν πολύ επιτυχής στο έργο του και η δημοτικότητά του αυξάνεται, ως αποτέλεσμα. Παράλληλα, έχει λάβει μεγάλη flack για τις μεθόδους του, καθώς συνιστούν σοβαρή απειλή για την επιχείρηση που είναι ο καρκίνος.

Τι είναι κανναβινοειδή;
κανναβινοειδή αναφέρονται σε οποιοδήποτε από μια ομάδα σχετικών ενώσεων που περιλαμβάνουν κανναβινόλη και των δραστικών συστατικών της κάνναβης. Ενεργοποιούν canbinoid υποδοχείς στο σώμα. Το ίδιο το σώμα παράγει ενώσεις που ονομάζονται ενδοκανναβινοειδή και παίζουν ρόλο σε πολλές διαδικασίες στο εσωτερικό του σώματος που βοηθούν να δημιουργηθεί ένα υγιές περιβάλλον. Τα κανναβινοειδή παίζουν επίσης ρόλο στο ανοσοποιητικό σύστημα και την παραγωγή νέου γενιάς. Το σώμα αναγεννάται καλύτερα όταν είναι κορεσμένο με Phyto-κανναβινοειδή. Κανναβινοειδή μπορεί επίσης να βρεθεί στην κάνναβη. Είναι σημαντικό να σημειωθεί ότι τα κανναβινοειδή είναι άφθονα σε τόσο κάνναβης και κάνναβης. Η διαφοροποίηση μεταξύ της κάνναβης και της κάνναβης είναι απλά ότι η κάνναβη περιέχει μόνο 0,3% THC, ενώ η κάνναβη είναι 0,4% THC ή υψηλότερη. (Τεχνικά και οι δύο στελέχη της Cannabis sativa).

Τα κανναβινοειδή έχουν αποδειχθεί ότι μειώνουν τα καρκινικά κύτταρα, καθώς έχουν μεγάλη επίδραση στην ανασυγκρότηση του ανοσοποιητικού συστήματος. Αν και δεν είναι κάθε στέλεχος της κάνναβης έχει το ίδιο αποτέλεσμα, όλο και περισσότεροι ασθενείς βλέπουν επιτυχία στη μείωση του καρκίνου σε σύντομο χρονικό διάστημα με τη χρήση κάνναβης. Αντίθετα με τη δημοφιλή πεποίθηση και σκέψης, το κάπνισμα κάνναβης δεν βοηθά πολύ στη θεραπεία της νόσου μέσα στο σώμα ως θεραπευτικά επίπεδα δεν μπορεί να επιτευχθεί μέσα από το κάπνισμα. Δημιουργία λάδι από το φυτό ή το φαγητό του φυτού είναι ο καλύτερος τρόπος να πάει για να πάρει τα απαραίτητα συστατικά τα οποία είναι τα κανναβινοειδή. Μια άλλη πτυχή του καπνίσματος, του κάνναβης που πρέπει να εξεταστεί είναι το γεγονός ότι όταν η κάνναβη είναι θερμαινόμενη και καίγεται αλλάζει τη χημική δομή και η οξύτητα του THC που αλλάζει την ικανότητά του να είναι θεραπευτική. Επιπλέον, κάθε φορά που καίνε κάτι και εισπνέει, μπορείτε να δημιουργήσετε οξείδωση στο εσωτερικό του σώματος. Η οξείδωση δεν είναι υγιές για το σώμα και μπορεί να οδηγήσει σε προβλήματα υγείας ίδια.

Κανναβινοειδή μπορεί να αποτρέψει τον καρκίνο, καρδιακές προσβολές μείωση κατά 66% και από ινσουλινοεξαρτώμενο διαβήτη κατά 58%. Η κάνναβη κλινικός ιατρός Δρ William Courtney συνιστά πόσιμο 4 έως 8 ουγγιές πρώτων λουλουδιών και το χυμό των φύλλων από κάθε φυτό κάνναβης.

Κάνναβη - αν Sativa, Indica, Ruderalis, αρσενικό, θηλυκό, ερμαφρόδιτο, άγρια, που εκτρέφονται για την παραγωγή ινών, οι σπόροι ή φαρμακευτικά ρητίνη - είναι ένα λαχανικό με κάθε βασικές διατροφικές δεν μπορούμε να συνθέσουμε: Τα βασικά αμινοξέα, απαραίτητα λιπαρά οξέα, αιθέρια οξέα Κανναβινοειδών και εκατοντάδες αντι-καρκίνου ενώσεων. Είναι σημαντικό να σημειωθεί ότι όταν απομονωθούν σε σημαντικές ενώσεις της κάνναβης και να τους συμπληρώσει χάνουμε από τα βιο-συνεργιστική ενώσεις που πηγαίνουν μαζί με αυτό σε πλήρη μορφή των φυτών. Αυτό καθιστά ακόμη πιο δύσκολο για το σώμα να προσδιορίσει τι ακριβώς λαμβάνει μέσα

"Αν θερμάνει το εργοστάσιο, θα αποκαρβοξυλιώνονται THC-οξέος και θα έχετε υψηλή, που" θα πάρετε 10 mg σας. Αν δεν το θερμάνει, μπορείτε να πάτε μέχρι πέντε ή εξακόσια χιλιοστόγραμμα και να το χρησιμοποιήσετε ως Διαιτητικά κάνναβη. . . και σπρώξτε μέχρι τα αντι-οξειδωτικό και νευρο-προστατευτικά επίπεδα που μπαίνουν στο παιχνίδι σε εκατοντάδες χιλιοστά του γραμμαρίου, "δήλωσε ο Δρ William Courtney.

Η ενδοκανναβινοειδούς συστήματος (ECS) διατηρεί βιολογικά συστήματα μας με τη ρύθμιση κάθε ιστό κυττάρων. Χρησιμοποιεί αραχιδονικό οξύ / Ωμέγα 6 για να κάνουν ενδο-κανναβινοειδή: λιπαρών μορίων που επικοινωνούν μεταξύ βλάβη των κυττάρων. Διαιτητικά κάνναβη μιμείται την ECS με την παροχή κανναβινοειδή όταν υπάρχει μια αραχιδονικό οξύ ανεπάρκεια ή ανεπάρκεια Κλινική κανναβινοειδή.

Οι γιατροί που έχουν έρευνα κάνναβη και τα οφέλη του στη διατροφή και αρκετό καιρό έχουν συστήσει ότι οι άνθρωποι κάνουν χρήση κάνναβης μέρος της καθημερινής διατροφής τους. Για να επαναλάβουμε, το φυτό δεν χρειάζεται να περιέχουν υψηλά επίπεδα της THC και μπορεί απλά να είναι κάνναβη. Η κατανάλωση κάνναβης που δεν περιέχουν THC δεν θα σας πάρει υψηλή. Επίσης, το κάπνισμα δεν δίνουν τα ίδια αποτελέσματα όπως το φαγητό ή την παρασκευή χυμού του φυτού. Αν δείτε το απλό φυτό ως λαχανικό, όπως όλα τα άλλα λαχανικά που τρώμε, είναι λογικό ότι δεν θα το βάλει μέσα χαρτάκια και καπνίζουν για να πάρει τα θρεπτικά οφέλη. (Χαχα)

ΑΤΑΛΟΓΟΣ ΑΣΘΕΝΕΙΩΝ ΚΑΙ ΘΕΡΑΠΕΙΑ ΤΟΥΣ ΜΕ ΤΑ ΑΝΤΙΣΤΟΙΧΑ ΒΟΤΑΝΑ

KΑΤΑΛΟΓΟΣ  ΑΣΘΕΝΕΙΩΝ ΚΑΙ ΘΕΡΑΠΕΙΑ ΤΟΥΣΜΕ ΤΑ ΑΝΤΙΣΤΟΙΧΑ ΒΟΤΑΝΑ

ΑΓΧΟΣ: Ηρεμεί με βασιλικό, θυμάρι, μαντζουράνα.

ΑΔΥΝΑΜΙΑ (οργανισμού): Δεντρολίβανο, Μαντζουράνα, Φασκόμηλο, Πιπεριές.

ΑΙΜΟΡΡΑΓΙΕΣ (εσωτερικές και εξωτερικές): Γλιστρίδα, δάφνη, βάλσαμο, Λουΐζα, απήγανος, αχίλλεα, βίνκα, δίκταμο, πεντάνευρο.

ΑΙΜΟΡΡΟΪΔΕΣ (ερεθισμός): Δεντρολίβανο, δάφνη, απήγανος, φλόμος, κρεμμύδι, μελιτζάνα.

ΑΜΥΓΔΑΛΙΤΙΔΕΣ: Οι ερεθισμένες από οποιοδήποτε λόγο αμυγδαλές θεραπεύονται με αγριμόνιο, δυόσμο, μέντα, θυμάρι, μαντζουράνα, αγριοτριανταφυλλιά, φασκόμηλο.

ΑΝΑΙΜΙΑ: Θυμάρι, μελισσόχορτο, δεντρολίβανο, ντομάτα.

ΑΝΑΠΝΕΥΣΤΙΚΕΣ ΠΑΘΗΣΕΙΣ: Χαμομήλι, θυμάρι, πανσές.

ΑΝΤΙΚΑΤΑΡΡΟΙΚΑ: Αγιόκλημα, αχίλλεα, βοράγο, λεβάντα, ονωνίδα, σάλβια, τίλιο, ρίγανη.

ΑΝΤΙΣΗΠΤΙΚΑ: Καλέντουλα, Αχιλλέα, βίνκα, δίκταμο, λεβάντα, μαντζουράνα, υπερικό, δεντρολίβανο, θυμάρι, τσάι βουνού, χαμομήλι.

ΑΣΘΜΑ: Αγριμόνιο, Αχιλλέα, βαλεριάνα, βάλσαμο, γαϊδουράγκαθο, δεντρολίβανο, ευκάλυπτος, σαμπούκος, θυμάρι, κρεμμύδι, λεβάντα, μαντζουράνα, μάραθο, μελισσόχορτο, ρίγανη, σέλινο, σκόρδο, τίλιο, χαμομήλι, ύσσωπος.

ΑΤΟΝΙΑ: Ιδιαίτερα για τη μυϊκή ατονία: Αχιλλέα, λεβάντα, φασκόμηλο, ρίγανη, μάραθος, σκόρδο, δάφνη, κορίανδρος, βασιλικός, δίκταμο.

ΑΫΠΝΙΑ: Βαλεριάνα, βάλσαμο, βασιλικός, δυόσμος, μέντα, ευκάλυπτος, λεβάντα, Λουΐζα, μαντζουράνα, μελισσόχορτο, χαμομήλι, δεντρολίβανο.

ΑΥΤΙΩΝ (πόνοι): Βασιλικός, κολοκυθιά, κρεμμύδι, μελισσόχορτο, μολόχα, σκόρδο, χαμομήλι.

ΑΦΘΕΣ: Δεντρολίβανο, αγριοτριανταφυλλιά, φασκόμηλο, χαμομήλι.

ΒΗΧΑΣ: Άσχετα με την αιτία που τον προκαλεί: αγριμόνιο, γλιστρίδα, βαλεριάνα, βασιλικός, γαϊδουράγκαθο, γλυκόριζα, ευκάλυπτος, σαμπούκο, θυμάρι, κρεμμύδι, μαϊντανός, μαντζουράνα, μολόχα, μάραθο, αγριοτριανταφυλλιά, φασκόμηλο, αμάραντο.

ΓΑΣΤΡΙΤΙΔΕΣ (γενικά): Αγριμόνιο, βασιλικός, χαμομήλι, λουίζα, μολόχα, φασκόμηλο.

ΓΡΙΠΗ: Δεντρολίβανο, ευκάλυπτος, θυμάρι, κρεμμύδι, λεβάντα, μάραθος, σινάπι, φλαμούρι, σκόρδο.

ΔΕΡΜΑΤΟΠΑΘΕΙΕΣ (γενικά): Σαμπούκος, κρεμμύδι, λεβάντα, μάραθος, μελισσόχορτο, φασκόμηλο, θυμάρι, Λουΐζα, μαϊντανός, χαμομήλι, πικροδάφνη.

ΔΙΑΡΡΟΙΕΣ (γενικά): Αγριμόνιο, ευκάλυπτος, κρεμμύδι, Λουΐζα, πατάτα, σκόρδο, σέλινο.

ΔΥΣΕΝΤΕΡΙΕΣ (γενικά): Αγριμόνιο, βάλσαμο, καρυδιά, καστανιά, ροδιά, σκόρδο, βάλσαμο.

ΔΥΣΚΟΙΛΙΟΤΗΤΕΣ: Αγριμόνιο, βασιλικός, σαμπούκος, καρπούζι, καστανιά, σκόρδο, τίλιο, αγριοτριανταφυλλιά, αγγούρι, ντομάτα.

ΔΥΣΜΗΝΟΡΡΟΙΕΣ: Απήγανος, Αχιλλέα, γαϊδουράγκαθο, δυόσμος, μέντα, θυμάρι, λεβάντα, Λουΐζα, μαϊντανός, μελισσόχορτο, φασκόμηλο, χαμομήλι.

ΔΥΣΠΕΨΙΑ: Αγριμόνιο, βάλσαμο, βασιλικός, δυόσμος, μέντα, κρεμμύδι, λεβάντα, μαϊντανός, μαντζουράνα, μελισσόχορτο, σκόρδο, χαμομήλι.

ΕΓΚΑΥΜΑΤΑ: Βάλσαμο, κολοκυθιά, ευκάλυπτος, θυμάρι, κρεμμύδι, λεβάντα, πατάτα, χαμομήλι.

ΕΚΖΕΜΑΤΑ: Δεντρολίβανο, κελέντουλα, λεβάντα, μαϊντανός, φασκόμηλο, χαμομήλι.

ΕΝΤΟΜΟΑΠΩΘΗΤΙΚΑ: Τεύκριο, βασιλικός.

ΕΞΑΝΘΗΜΑΤΑ: Αγριμόνιο, γαϊδουράγκαθο, μολόχα, πατάτα.

ΕΠΙΠΕΦΥΚΙΤΙΔΕΣ (γενικά): Μαϊντανός, καλεντούλα.

ΖΑΛΑΔΕΣ: Άσχετα με την αιτία που τις προκαλούν: βάλσαμο, βασιλικός, δεντρολίβανο, λεβάντα, μαϊντανός, μαντζουράνα, μελισσόχορτο, αγριοτριανταφυλλιά, χαμομήλι.

ΗΛΙΑΣΗ: Σαν πρώτες βοήθειες αφέψημα σαμπούκου.

ΗΜΙΚΡΑΝΙΕΣ: Αγριμόνιο, βαλεριάνα, δεντρολίβανο, θυμάρι, λεβάντα, μαντζουράνα, μελισσόχορτο, τίλιο και χαμομήλι.

ΗΡΕΜΙΣΤΙΚΑ: Βάλσαμο, λεβάντα, αγριοτριανταφυλλιά.

ΚΑΛΟΙ: Βάλσαμο, καλέντουλα, μολόχα, πατάτα, σκόρδο.

ΚΟΛΙΚΟΙ (διάφοροι): Απήγανος, βάλσαμο, δυόσμος, καρυδιά, κρεμμύδι, κρόκος, μαντζουράνα, μέντα, μολόχα.

ΚΡΥΟΛΟΓΗΜΑΤΑ: Αχιλλέα, σαμπούκο, θυμάρι, κρεμμύδι, μαϊντανός, μαντζουράνα, πατάτα, σινάπι, χαμομήλι.

ΛΟΞΙΓΚΑΣ: Βαλεριάνα, δυόσμος, μέντα, ρίγανη.

ΜΑΤΙΩΝ (ερεθισμοί): Καρπούζι, κρόκος, Λουΐζα. μαϊντανός, μάραθο, ραδίκι.

ΜΕΛΑΝΙΕΣ: Αγριμόνιο, βασιλικός, δεντρολίβανο, θυμάρι, κρεμμύδι, μαϊντανός, μάραθο, μελισσόχορτο, μολόχα, πατάτα, σινάπι.

ΜΥΤΗΣ (αιμορραγίες): Φλαμουριά.

ΜΩΛΩΠΕΣ: Αχιλλέα, αθανασία, βιόλα, πιπεριά (κόκκινη), βάλσαμο.

ΝΑΥΤΙΕΣ: Γαϊδουράγκαθο, κολοκυθιά, λεβάντα, μάραθο, ρίγανη.

ΟΡΕΚΤΙΚΑ: Αχιλλέα, βασιλικός, θυμάρι, κρεμμύδι, κρόκος, ραδίκι, σκόρδο.

ΠΛΗΓΕΣ: Μαλακώνουν με βιόλα, βίνκα, καλέντουλα.

ΠΟΝΟΔΟΝΤΟΙ: Δίκταμος, δυόσμος, σαμπούκος, θυμάρι, καρυδιά, κισσός, κρεμμύδι, λεβάντα, μαντζουράνα, μέντα, ρίγανη, σινάπι, χαμομήλι.

ΠΡΗΞΙΜΑΤΑ: Αγριμόνιο, μάραθος, μαντζουράνα, πατάτα, ραδίκι, σκόρδο, σινάπι, χαμομήλι, απήγανος.

ΠΥΡΕΤΟΙ: Αθανασία, βαλεριάνα, δίκταμο, ευκάλυπτος, καρπούζι, καστανιά, Λουΐζα, μαϊντανός, σέλινο, τίλιο, χαμομήλι.

ΣΤΟΜΑΧΙΚΑ: Αχιλλέα, κολοκυθιά, γαϊδουράγκαθο, δίκταμο, κορίανδρος, Λουΐζα, μιλισσόχορτο, ραδίκι. Συγκεκριμένα για τα έλκη: βάλσαμο, πατάτα, τσουκνίδα και για τις νευρώσεις: χαμομήλι.

ΤΟΝΩΤΙΚΑ (γενικά του οργανισμού): Βαλεριάνα, απήγανος, σινάπι, χαμομήλι, αθανασία, Αχιλλέα.

ΤΣΙΜΠΗΜΑΤΑ ΕΝΤΟΜΩΝ: Αγριμόνιο, δυόσμος, θυμάρι, καρυδιά, κρεμμύδι, λεβάντα, μαϊντανός, μελισσόχορτο, μολόχα, μέντα, σκόρδο, φασκόμηλο.

ΤΥΜΠΑΝΙΣΜΟΣ κοιλιάς: Βασιλικός, μάραθο, μελισσόχορτο, ρίγανη, σκόρδο, χαμομήλι.

ΥΠΕΡΚΟΠΩΣΗ Δεντρολίβανο, κρεμμύδι, φασκόμηλο.

ΥΠΕΡΤΑΣΗ (γενικά): γλιστρίδα, δεντρολίβανο, κρεμμύδι, λεβάντα, μαϊντανός, μελισσόχορτο, σέλινο, σκόρδο.

ΥΠΟΤΑΣΗ: Δάφνη, θυμάρι, φασκόμηλο.

ΧΙΟΝΙΣΤΡΕΣ: Γαϊδουράγκαθο, καρυδιά, σέλινο.

Yerba Mate

Yerba Mate 

H Yerba Mate είναι ένα απίστευτο τσάι από βότανα, που έχει πολύ υψηλή περιεκτικότητα σε θρεπτικές σε βιταμίνες, μέταλλα και ενώσεις.

H Yerba Mate τσάι χρησιμοποιείται ευρέως σε ολόκληρη τη Νότια Αμερική ως διεγερτικό της όρεξης και.

Σε μια μελέτη από τον Ιούνιο του 2001, που δημοσιεύθηκε στην Εφημερίδα της Ανθρώπινης Διατροφής και Διαιτολογίας, Yerba Mate βρέθηκε να επιβραδύνει την πέψη, ενώ επιταχύνει το μεταβολισμό του σώματος.

-Αυτό δείχνει ότι η ώθηση αυξάνει σημαντικά την απώλεια βάρους-.

Yerba Mate οφέλη για την υγεία είναι πολύ παρόμοια με εκείνα του πράσινου τσαγιού. Ωστόσο, μελέτες έχουν δείξει Yerba Mate να διαθέτει έως και 90% περισσότερο το μεταβολισμό θρεπτικών συστατικών από την ενίσχυση του πράσινου τσαγιού. Παράγει επίσης μια υψηλότερη συγκέντρωση των πολυφαινολών, αντιοξειδωτικές ιδιότητες, και η θρεπτική αξία.

Μερικά οφέλη για την υγεία Yerba σύντροφος είναι ότι απελευθερώνει σεροτονίνη και φέρνει τα συναισθήματα της ευημερίας και την ικανοποίηση. Είναι ένα μεγάλο ασανσέρ διάθεση. Πρόσφατες μελέτες έχουν δείξει ότι οι πότες Yerba σύντροφος είναι πιο επιρρεπείς να έχουν θετικές σκέψεις και μια θετική προοπτική στη ζωή.

-Βοηθά να απαλλαγείτε από το περιττό βάρος του σώματος με τη μείωση της πείνας και κάψιμο περίσσεια λίπους.

-Πολύ καλό αποτοξινωτικό. Ξεμπλοκάρει το πεπτικό σύστημα φορέων και ξεφορτώνεται τοξινών στο σώμα και αίμα.

-Δίνει ώθηση της φυσικής ενέργειας, χωρίς μια «σταγόνα» ή για την ενδεχόμενη κούραση όπως ο καφές ή άλλες τονωτικές ουσίες.

-Βοηθά παράγουν βαθύτερο ύπνο τη νύχτα και μπορεί σε πολλές περιπτώσεις να θεραπεύσει την αϋπνία

- Περιέχει σαπωνίνες που ενισχύουν το ανοσοποιητικό σύστημα

-Αυξάνει την εστίαση και την πνευματική συγκέντρωση

-Χαλαρώνει τον εγκέφαλο και τους μυς του σώματος

Μπορείτε να βρείτε Yerba Mate στο τοπικό κατάστημα υγιεινής διατροφής σας σε τόσο τσάντα τσάι και βότανα χύμα μορφή.